Journal: Molecular Oncology
Article Title: FANCD2 limits acetaldehyde‐induced genomic instability during DNA replication in esophageal keratinocytes
doi: 10.1002/1878-0261.13072
Figure Lengend Snippet: FANCD2 depletion exacerbates acetaldehyde‐induced loss of viability. (A) EPC2‐hTERT cells were depleted of FANCD2 via a doxycycline‐inducible shRNA lentiviral infection. Control and FANCD2‐depleted cells were lysed, and FANCD2 levels were assessed via western blot. Nucleolin was used as a loading control. (B) Control and FANCD2‐depleted EPC2‐hTERT cells were treated with up to 1 m m acetaldehyde (AA) for 48 h, and cell viability was assessed via trypan blue exclusion. Relative cell viability was calculated against viability of nontreated cells (0 m m AA) n = 3. Student's t ‐test, * P < 0.05. Error bars indicate SEM. (C) TE11 cells constitutively expressing control or FANCD2 shRNAs were treated with indicated concentrations of acetaldehyde. Cells were selected by puromycin and lysed, and FANCD2 levels were monitored. (D) The cells used in C were also assessed for viability using trypan blue exclusion. Relative cell viability was calculated as described in B. (E) Control and FANCD2‐depleted TE11 cells were suspended in Matrigel and grown into 3D esophageal organoids. Cells were treated with up to 4 m m AA for the first 72 h of organoid formation, and then, acetaldehyde‐free media was added as organoids continued to grow for 10 days. Following organoid formation, organoids were photographed, and organoid formation rates (%) were calculated against the initial number of plated cells. (F) Relative organoid formation rates (%) were recalculated by normalizing organoid formation rates to those of untreated samples in both control and FANCD2 shRNA‐expressing cells. Student's t ‐test; ** P < 0.01 and *** P < 001. n = 3. Error bars indicate SEM.
Article Snippet: Constitutive short hairpin RNA (shRNA)‐mediated gene silencing was performed using the lentiviral vector pLKO.1‐PURO encoding shRNA sequences for scrambled control (Addgene plasmid #1864, described previously [ ]), FANCD2 (mature antisense: AATCCTCCAATCTAATAGACG, GE Dharmacon TRCN0000082838), and TIMELESS (mature antisense: AATGCAATGGTTAGTGTGGGC, GE Dharmacon TRCN0000157211, described previously [ ]).
Techniques: shRNA, Infection, Western Blot, Expressing
Addgene inc is a verified supplier 
